Displaying 20 results from an estimated 10000 matches similar to: "Applying do.call to a data.frame using function arguments"
2010 Nov 12
3
Replicate Excel's LOGEST worksheet function in R
Hi -
I have a dataframe of (x,y) values. I'd like to fit an exponential
curve to the data for further statistical analysis (pretty much the same
functionality provided by Excel's LOGEST worksheet array function). Can
someone point me to the (set of) functions/ package that is best suited to
provide this functionality? Admittedly, I am a novice in the use of R
statistical functions,
2009 Nov 25
3
Feature request for as.Date() function
Hello -
I have a csv file with a few date columns. Some of the records have an
"NA" character string instead of the date. When I attempt to use
read.csv() and typecast the columns using colClasses, I receive the
following error:
Error in charToDate(x) :
character string is not in a standard unambiguous format
Similarly, the following command produces the same error:
2009 Nov 15
2
Segmentation faults on SEXP conversion
Hello -
I am making a first attempt at writing a simple C++ routine to print
out R objects (this is a simple proof-of-concept as part of a larger
package development). The relevant C++ routine is as follows:
void Rwrite(SEXP fd, SEXP msg) {
int *ofd = INTEGER(fd);
const char * omsg = CHAR(asChar(msg));
printf("[%i] %s",*ofd,omsg);
}
And the corresponding interface in R is as
2009 Jul 11
1
Passing arguments to forked children
Hi -
I have attempted to use the fork::fork() function to perform
parallel processing. However, the child R function called needs to
know a given set of parameters to complete its task. Specifically, I
iterate through a vector, and output values based on the elements of
that vector to a database. The output strings contain elements of the
iterated vector. I mocked-up the following code as an
2010 Jan 19
2
Memory usage in read.csv()
I'm sure this has gotten some attention before, but I have two CSV
files generated from vmstat and free that are roughly 6-8 Mb (about
80,000 lines) each. When I try to use read.csv(), R allocates all
available memory (about 4.9 Gb) when loading the files, which is over
300 times the size of the raw data. Here are the scripts used to
generate the CSV files as well as the R code:
Scripts (run
2009 Jun 12
1
Masked user input
Hi -
I'm creating a package of database tools. A function in the package
requires the username and password as input to the function in order to
initially connect to the target database(s). Of course, this poses a
significant security issue given the possible retention of the function
statement in cleartext. I did not readily encounter a package meant to mask
input from the user nor do I
2018 Sep 18
0
Suggested Patch: Adding commas to list of packages after R CMD check
On 18/09/2018 2:16 PM, Marcel Ramos wrote:
> Dear R-devs,
>
>
> Scenario:
>
> When checking a package via `R CMD check package_tar.ball`, required / suggested packages may be missing. R subsequently returns a list of packages that are missing (delimited by spaces).
>
> Example:
>
> ```
> R CMD check glmSparseNet_0.99.13.tar.gz
> * using log directory
2018 Sep 18
2
Suggested Patch: Adding commas to list of packages after R CMD check
Dear R-devs,
Scenario:
When checking a package via `R CMD check package_tar.ball`, required / suggested packages may be missing. R subsequently returns a list of packages that are missing (delimited by spaces).
Example:
```
R CMD check glmSparseNet_0.99.13.tar.gz
* using log directory '/home/ubuntu/Bioconductor/glmSparseNet.Rcheck'
* using R Under development (unstable) (2018-06-06
2008 Apr 29
4
Applying user function over a large matrix
Respected R experts,
I am trying to apply a user function that basically calls and
applies the R loess function from stat package over each time
series. I have a large matrix of size 21 X 9000000 and I need
to apply the loess for each column and hence I have
implemented this separate user function that applies loess
over each column and I am calling this function foo as follows:
2009 Jan 26
1
Large regular expressions
Given a vector of reference strings Ref and a vector of test strings
Test, I would like to find elements of Test which do not contain
elements of Ref as \b-delimited substrings.
This can be done straightforwardly for length(Ref) < 6000 or so (R
2.8.1 Windows) by constructing a pattern like \b(a|b|c)\b, but not for
larger Refs (see below). The easy workaround for this is to split Ref
into
2010 May 11
3
Advice needed on awkward tables
Dear r-help list members,
I am quite new to R, and hope to seek advice from you about a problem I have
been cracking my head over. Apologies if this seems like a simple problem.
I have essentially two tables. The first (Table A) is a standard patient
clinicopathological data table, where rows correspond to patient IDs and
columns correspond to clinical features. Records in this table are stored
2008 Nov 18
2
sequencially merge multiple files in a folder
Dear all,
If the question is too easy, please forgive me since I am only few weeks old in R.
I have worked on this question a few days and still cannot figure it out.
Here I have a folder with more than 50 tab-delimited files. Each file has a few hundreds of thousands rows/subjects, and the number of columns/variables of each file varies.The 1st row consists of all the variable names.
Now I
2002 Jun 19
1
new version of print.factor
Thanks to Tony Plate for letting me know what the abbreviate.arg
option does. I think this could be made more flexible (I.e.
=TRUE, =FALSE, =#, where # would be passed to the abbreviate
min.length argument). But it follows the example I was given.
"print.factor" <-
function (x, quote = FALSE, max.levels=5, print.levels = {if
(max.levels==0) FALSE else TRUE},
2007 Nov 02
0
applying duplicated, unique and match to lists?
Dear R developers,
While improving duplicated.array() and friends and developing equivalents for the new ff package for large datasets I came across two questions:
1) is it safe to use duplicated.default(), unique.default() and match() on arbitrary lists? If so, we can speed up duplicated.array and friends considerably by using list() instead of paste(collapse="\r")
2) while
2008 Nov 07
2
Applying a function to a list of arguments ...
How can I apply function f, that I get as an argument as in
func <- function(f, ...) {
.
.
.
}
to a list of arguments list(a, b, c) (eg the ... argument of func above)
in order to obtain
f(a, b, c)
Thanks a lot,
Roberto
[[alternative HTML version deleted]]
2009 Oct 19
1
rbind to array members
(resent as hotmail really cannot format plaintext, but I've just read
Tony Plate's message that what I'd like to do might not be possible)
>
> library(abind) ## array binding
I've looked into using abind() but it seems I might not understand it properly.
I can build my 2 table array and insert a row into each table using:
x <- array(0,c(1,3,2))
x[,,1]
2009 Oct 29
0
In the result of applying 'bquote' to function definition with 2 or more arguments, first function argument disappears (PR#14031)
Full_Name: Suharto Anggono
Version: 2.8.1
OS: Windows
Submission from: (NULL) (125.165.81.124)
Sorry for repost. There is already PR#9602, but the problem is still there.
There is also a post "Re: [R] using bquote to construct function" in R-help
2008-10-02.
This illustrates the problem.
C:\Program Files\R\R-2.8.1\bin>R --vanilla
R version 2.8.1 (2008-12-22)
Copyright (C) 2008
2013 Jun 11
1
Help needed in feature extraction from two input files
Hi,
Try this:
lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793
gene4 or2|347
gene5 or3|23 or7|123456789"))
lines2<-readLines(textConnection(">or1|1234
ATCGGATTCAGG
>or2|347
GAACCTATCGGGGGGGGAATTTATATATTTTA
>or3|56
ATCGGAGATATAACCAATC
>or3|23
AAAATTAACAAGAGAATAGACAAAAAAA
>or4|793
ATCTCTCTCCTCTCTCTCTAAAAA
>or7|123456789
2012 Jan 19
2
Reading in tab (and space) delimited data within a script XXXX
Hello everyone,
I use Bob Muenchen's approach for reading in "in-stream" (to use SAS
parlance) delimited data within a script. This works great:
mystring <-
"id,workshop,gender,q1,q2,q3,q4
1,1,f,1,1,5,1
2,2,f,2,1,4,1
3,1,f,2,2,4,3
4,2, ,3,1, ,3
5,1,m,4,5,2,4
6,2,m,5,4,5,5
7,1,m,5,3,4,4
8,2,m,4,5,5,5"
mydata <- read.table( textConnection(mystring),
2011 Oct 06
1
Issue with read.csv treatment of numerics enclosed in quotes (and a confession)
Dear Help-Rs,
I've been dealing with this problem for some time, using a work-around to deal with it. It's time for me to come clean with my ineptitude and seek a what has got to be a more streamlined solution from the Help-Rverse.
I regularly import delimited text data that contains numerics enclosed in quotes (e.g., "00765288071"). Thing is, for some of these data, I need