similar to: Applying do.call to a data.frame using function arguments

Hi - I have a dataframe of (x,y) values. I'd like to fit an exponential curve to the data for further statistical analysis (pretty much the same functionality provided by Excel's LOGEST worksheet array function). Can someone point me to the (set of) functions/ package that is best suited to provide this functionality? Admittedly, I am a novice in the use of R statistical functions,

Hello - I have a csv file with a few date columns. Some of the records have an "NA" character string instead of the date. When I attempt to use read.csv() and typecast the columns using colClasses, I receive the following error: Error in charToDate(x) : character string is not in a standard unambiguous format Similarly, the following command produces the same error:

Hello - I am making a first attempt at writing a simple C++ routine to print out R objects (this is a simple proof-of-concept as part of a larger package development). The relevant C++ routine is as follows: void Rwrite(SEXP fd, SEXP msg) { int *ofd = INTEGER(fd); const char * omsg = CHAR(asChar(msg)); printf("[%i] %s",*ofd,omsg); } And the corresponding interface in R is as

Hi - I have attempted to use the fork::fork() function to perform parallel processing. However, the child R function called needs to know a given set of parameters to complete its task. Specifically, I iterate through a vector, and output values based on the elements of that vector to a database. The output strings contain elements of the iterated vector. I mocked-up the following code as an

I'm sure this has gotten some attention before, but I have two CSV files generated from vmstat and free that are roughly 6-8 Mb (about 80,000 lines) each. When I try to use read.csv(), R allocates all available memory (about 4.9 Gb) when loading the files, which is over 300 times the size of the raw data. Here are the scripts used to generate the CSV files as well as the R code: Scripts (run

Hi - I'm creating a package of database tools. A function in the package requires the username and password as input to the function in order to initially connect to the target database(s). Of course, this poses a significant security issue given the possible retention of the function statement in cleartext. I did not readily encounter a package meant to mask input from the user nor do I

On 18/09/2018 2:16 PM, Marcel Ramos wrote: > Dear R-devs, > > > Scenario: > > When checking a package via `R CMD check package_tar.ball`, required / suggested packages may be missing. R subsequently returns a list of packages that are missing (delimited by spaces). > > Example: > > ``` > R CMD check glmSparseNet_0.99.13.tar.gz > * using log directory

Dear R-devs, Scenario: When checking a package via `R CMD check package_tar.ball`, required / suggested packages may be missing. R subsequently returns a list of packages that are missing (delimited by spaces). Example: ``` R CMD check glmSparseNet_0.99.13.tar.gz * using log directory '/home/ubuntu/Bioconductor/glmSparseNet.Rcheck' * using R Under development (unstable) (2018-06-06

Respected R experts, I am trying to apply a user function that basically calls and applies the R loess function from stat package over each time series. I have a large matrix of size 21 X 9000000 and I need to apply the loess for each column and hence I have implemented this separate user function that applies loess over each column and I am calling this function foo as follows:

Given a vector of reference strings Ref and a vector of test strings Test, I would like to find elements of Test which do not contain elements of Ref as \b-delimited substrings. This can be done straightforwardly for length(Ref) < 6000 or so (R 2.8.1 Windows) by constructing a pattern like \b(a|b|c)\b, but not for larger Refs (see below). The easy workaround for this is to split Ref into

Dear r-help list members, I am quite new to R, and hope to seek advice from you about a problem I have been cracking my head over. Apologies if this seems like a simple problem. I have essentially two tables. The first (Table A) is a standard patient clinicopathological data table, where rows correspond to patient IDs and columns correspond to clinical features. Records in this table are stored

Dear all, If the question is too easy, please forgive me since I am only few weeks old in R. I have worked on this question a few days and still cannot figure it out. Here I have a folder with more than 50 tab-delimited files. Each file has a few hundreds of thousands rows/subjects, and the number of columns/variables of each file varies.The 1st row consists of all the variable names. Now I

Thanks to Tony Plate for letting me know what the abbreviate.arg option does. I think this could be made more flexible (I.e. =TRUE, =FALSE, =#, where # would be passed to the abbreviate min.length argument). But it follows the example I was given. "print.factor" <- function (x, quote = FALSE, max.levels=5, print.levels = {if (max.levels==0) FALSE else TRUE},

Dear R developers, While improving duplicated.array() and friends and developing equivalents for the new ff package for large datasets I came across two questions: 1) is it safe to use duplicated.default(), unique.default() and match() on arbitrary lists? If so, we can speed up duplicated.array and friends considerably by using list() instead of paste(collapse="\r") 2) while

How can I apply function f, that I get as an argument as in func <- function(f, ...) { . . . } to a list of arguments list(a, b, c) (eg the ... argument of func above) in order to obtain f(a, b, c) Thanks a lot, Roberto [[alternative HTML version deleted]]

(resent as hotmail really cannot format plaintext, but I've just read Tony Plate's message that what I'd like to do might not be possible) > > library(abind) ## array binding I've looked into using abind() but it seems I might not understand it properly. I can build my 2 table array and insert a row into each table using: x <- array(0,c(1,3,2)) x[,,1]

Full_Name: Suharto Anggono Version: 2.8.1 OS: Windows Submission from: (NULL) (125.165.81.124) Sorry for repost. There is already PR#9602, but the problem is still there. There is also a post "Re: [R] using bquote to construct function" in R-help 2008-10-02. This illustrates the problem. C:\Program Files\R\R-2.8.1\bin>R --vanilla R version 2.8.1 (2008-12-22) Copyright (C) 2008

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

Hello everyone, I use Bob Muenchen's approach for reading in "in-stream" (to use SAS parlance) delimited data within a script. This works great: mystring <- "id,workshop,gender,q1,q2,q3,q4 1,1,f,1,1,5,1 2,2,f,2,1,4,1 3,1,f,2,2,4,3 4,2, ,3,1, ,3 5,1,m,4,5,2,4 6,2,m,5,4,5,5 7,1,m,5,3,4,4 8,2,m,4,5,5,5" mydata <- read.table( textConnection(mystring),

Dear Help-Rs,   I've been dealing with this problem for some time, using a work-around to deal with it. It's time for me to come clean with my ineptitude and seek a what has got to be a more streamlined solution from the Help-Rverse.   I regularly import delimited text data that contains numerics enclosed in quotes (e.g., "00765288071").  Thing is, for some of these data, I need