similar to: Summarizing each row into a frequency table

I am given a text file of records to be converted into a table format. I have searched related topics or packages, but can't find any similar cases. Please help. Sample record is given below. Take note the last element doesn't have a semi colon. ###---------Start of record---------------------- Name : John Height: 170cm Weight : 70kg Age: 30 Status: Married Children: 2 Employment

I tried cast and melt in reshape package, but still can't convert this data frame m m [,1] [,2] [1,] "A" "1" [2,] "A" "2" [3,] "B" "3" to this form. m1 [,1] [,2] [1,] "A" "B" [2,] "1" "3" [3,] "2" NA Please help. [[alternative HTML version deleted]]

I am cleaning up comma-limited values, so that only one comma separates each value. Using the example below, as much as I try with regex, I can't remove the last comma. I hope to have a one-liner solution, if possible. gsub("^,*|,*$|(,)*", "\\1", ",,,apple,,orange,,,,,lemon,strawberry,,,,") [1] "apple,orange,lemon,strawberry,"

I need to have the maths symbol for >= in the legend, and to substitute threshold variable with its value. Somehow, various attempts weren't successful. Please help. threshold <- 0.5 plot(NA, xlab="", ylab="", main="", axes=F, xlim=c(0,1), ylim=c(0,1), xaxs="i", yaxs="i") legend(x=0, y=1, fill=c("orange", "white",

I would like to convert a list to matrix. This can be easily achieved via do.call. The only problem is each element of the list has different length, which causes the recycling of values. How can I have NA instead of recycled values ? m <- list() m[["A"]] <- 1 m[["B"]] <- 2:3 do.call(rbind, m) [,1] [,2] A 1 1 B 2 3 [[alternative HTML version deleted]]

I am inserting a DNA sequence into a plot, and hope to colourize each of the four nucleotide of the DNA sequence with a unique colour i.e., A ("red"), C ("green"), G ("blue", and T ("yellow"). I use the following codes, but the DNA sequence only shows as "red" DNA <- "ACGT" plot(1, xlim = c(0,1), ylim = c(0,1), axes=F,

> set.seed(999) > abs(rnorm(20)) [1] 0.28174016 1.31255963 0.79518398 0.27007049 0.27730642 0.56602374 1.87865826 1.26679114 0.96774968 1.12100936 1.32546371 0.13397739 0.93874945 [14] 0.17253810 0.95765045 1.36268625 0.06833513 0.10065765 0.90134475 2.07435711 > v <- abs(rnorm(20)) > v [1] 1.2285633 0.6430443 0.3597629 0.2940356 1.1252685 0.6422657 1.1067376 0.8848404 1.5540951

I managed to find toupper() which translates all letters to uppercase. Is there a function to capitalize only the first letter of word or phrase ? Thanks

Hi, On my laptop, R is installed on windows XP SP2 at D:\Program Files\R\R-2.8.0, and all add-on packages are installed at D:\Program Files\R\R-2.8.0.libs. In addition, I have created two environment enviroment to ease upgrading and installation of packages. Packages installed is a mix of those from CRAN, Bioconductor and local zips. D:\My Document\My Desktop>echo %R_HOME% D:/Program

For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]

For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

I am using read.table("data.txt", sep="\t") to read in a tab-limited text file. However, two columns of data were read wrongly. read.table converts "+" and "-" in the two columns to 0. I have tried setting other parameters but to no avail. TIA _________________________________________________________________ Get in touch with your inner athlete. Take the

unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ? _________________________________________________________________ Easily edit your photos like a pro with Photo Gallery. [[alternative HTML version deleted]]

I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

Hi, How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ? t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14)) _________________________________________________________________ [[alternative HTML version deleted]]

Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for

Is there a better or more efficent approach than this without the use of t() ? > (m <- matrix(1:40, ncol=4)) [,1] [,2] [,3] [,4] [1,] 1 11 21 31 [2,] 2 12 22 32 [3,] 3 13 23 33 [4,] 4 14 24 34 [5,] 5 15 25 35 [6,] 6 16 26 36 [7,] 7 17 27 37 [8,] 8 18 28 38 [9,] 9 19 29 39[10,] 10 20 30 40 >

I need to write a data frame along with its column and row names to a text file. However, the first row in the text file is always short of one element. I have tried setting different parameters to write.table but that didn't help. > m A B C 1 2 D 3 4 Using write.table(m, "table.xls", sep="\t", col.names=T, row.names=T) gives A B C 1 2 D 3 4