similar to: Profiling question: string formatting extremely slow

I don''t like this: i = mock(Integer) i.should_receive(:asdfasdf).and_return(''foo'') puts i.asdfasdf Shouldn''t rspec check to see that :asdfasdf is a valid message to be sending Integer? Joe

Anyone got a good validation for validating a phone number? I just want to make sure that whatever the user enters is somewhat sensical, and i''d like to be fairly liberal about what kind of a format it''s in. Joe

> > If we do end up creating ARM binaries for the general public, your input > > and expertise will be greatly appreciated! ;) > I will be happy to provide some Debian & Ubuntu ARM packages. I just > need access to ARM server(s). I don't know if there is such server available. If so, I also would like give help. :) Regards, chenwj -- Wei-Ren Chen (陳韋任) Computer

On 03/04/2013 11:07, Renato Golin wrote: > On 1 April 2013 22:05, Bill Wendling <wendling at apple.com > <mailto:wendling at apple.com>> wrote: > > We would like to support ARM again. > > > Hi Bill, > > Glad you asked! ;) [...] > Sylvestre, > > If we do end up creating ARM binaries for the general public, your input > and expertise will

Hi, I would like to replace the last tree characters of the values of a certain column in a dataframe. This replacement should only take place if the last three characters correspond to the value "/:/" and they should be replaced with ""(blank) I cannot perform a simple gsub because the characters /:/ might also be present somewhere else in the string values and then they

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

hello, I'd like know how to sort a data frame in R for example how I should do to sort by Catholic with swiss data frame like below thanks Fertility Agriculture Examination Education Catholic Infant.Mortality Courtelary 80.2 17.0 15 12 9.96 22.2 Delemont 83.1 45.1 6 9 84.84 22.2

Main question: is it safe, to open a port for an openssl server? e.g.: server side - generate a self-signed cert. time openssl req -x509 -nodes -days 365 -newkey rsa:8192 -keyout mycert.pem -out mycert.pem openssl s_server -accept 52310 -cert mycert.pem Is it secure? - it could be DOSed' [DenialofService] or could it be attacked in any way? Are there any iptables rule for restricting

Sadly, I'm back with another issue. I can do a "system list --all" just fine; however, if I attempt to start the machines, I get back: maas@Bill-MAAS-cc:~$ strace -s 1024 -f -o /tmp/asdfasdf.log virsh -c vbox+ssh://gbadmin@10.20.0.1/system start PXE-client-07 error: Failed to start domain PXE-client-07 error: An error occurred, but the cause is unknown Log files on both client

Hello, I am new to Asterisk, as of today. Installed on a RH9 box, with no problems. Built with 'make samples' as to get an understanding of how things work. Currently, I am utilizing SJPhone as a SIP client - not interested in shelling out cash for the IP phones, until I know I have a hold on things. I have run into a few problems I was hoping you could help me with : 1. When

Hi fantastic rails core developers. Speaking of version 2.3.5: I find it rather error_prone that values such that "some text" is silently converted to false when stored in a boolean DB field. Among other things it means that assign "some text" to boolean fields on a model will not generate any validation messages (it will silently be converted to false). I think it is like

I'm not sure if this is a bug or a limitation that can be worked around with a setting somewhere, but I have found a problem with cygwin 1.7 while using rsync. I have been using rsync and cygwin v1.5 for quite some time. I recently started testing cygwin v1.7 and I ran into a problem with an apparent limit on the number of files cygwin 1.7 along with rsync can process in a directory. First

jÇ_jÇ_

[Moved from -current to -stable] ???????? 21 ???????? 2006 16:23, Matthew Dillon ?? ????????: > ? ? You might be doing just writes to the mmap()'d memory, but the system > ? ? doesn't know that. Actually, it does. The program tells it, that I don't care to read, what's currently there, by specifying the PROT_READ flag only. > ? ? The moment you touch any mmap()'d

Hi, Email notifications are an important part of my app and I would like to spec them. Here''s what I have going so far. It seems to work. I''d appreciate comments/suggestions. Rails script/generate mailer produces tests for the email contents etc. I''ve started by manually converting the generated unit tests to rspec, and then changing/adding examples as I

Full_Name: Jens Oehlschl?gel Version: 2.10.0 OS: Windows XP Submission from: (NULL) (85.181.157.36) file_path_as_absolute duplicates "/" for files in the root path, which goes back to the fact that file.path(dirname(x), basename(x)) currently is not guaranteed to restore x > x <- "d:/x.RDAta" > file_path_as_absolute(x) [1] "d://x.RData" >

On Tue, Apr 9, 2013 at 1:43 AM, 陳韋任 (Wei-Ren Chen) <chenwj at iis.sinica.edu.tw > wrote: > > > If we do end up creating ARM binaries for the general public, your > input > > > and expertise will be greatly appreciated! ;) > > I will be happy to provide some Debian & Ubuntu ARM packages. I just > > need access to ARM server(s). > > I don't

Commit-ID: 8443e57e5ba71e462e31e3b5aad9f7dd1b4736f5 Gitweb: http://git.kernel.org/?p=libs/klibc/klibc.git;a=commit;h=8443e57e5ba71e462e31e3b5aad9f7dd1b4736f5 Author: Ben Hutchings <ben at decadent.org.uk> AuthorDate: Tue, 5 Nov 2019 00:39:53 +0000 Committer: Ben Hutchings <ben at decadent.org.uk> CommitDate: Tue, 5 Nov 2019 00:44:32 +0000 [klibc] losetup: Fix char signedness

hello hpa, please review this unsorted patch queue, as I wasn't sure about them they didn't land yet in todays pull request. thanks max git clone git://git.debian.org/users/maks/klibc.git test Thomas B?chler (1): klcc: compile shared by default jeremy buisson (1): [klibc] sparc64: fix bad 32 bits socket syscalls maximilian attems (1): [klibc] add losetup utils the

On Wed, Nov 25, 2015 at 04:17:47PM -0500, Ken D'Ambrosio wrote: >Sadly, I'm back with another issue. I can do a "system list --all" >just fine; however, if I attempt to start the machines, I get back: > >maas@Bill-MAAS-cc:~$ strace -s 1024 -f -o /tmp/asdfasdf.log virsh -c >vbox+ssh://gbadmin@10.20.0.1/system start PXE-client-07 >error: Failed to start domain