similar to: distribution of peaks in random data results

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, I would like to know if there is any R package that uses a sliding window approach to assess statistical significance out of my data. My data is composed of DNA sequences (of variable length) that are mapped to a genome with a determined score of alignment. So, I want to see if I can find more tags in a given region of the genome as opposed to finding them by chance. In this sliding

Dear all, I would like to know how can I test which are the intervals of my data that have significant less or more counts than the other intervals. Example: Interval [1:200] [200:400] [400:600] [600:800] ... more 900 hundred columns Count 12 28 7 5 Thanks in advance, Best regards João Fadista Ph.d.

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.

Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of

Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear R-helpers, I'm not a speciallist in writing complex functions, and the function still very rusty (any kind of suggestions are very welcome). I want to implement Gale-Shapley algorithm for R Language. It is based on http://www.jstor.org/stable/10.2307/2312726 Gale and Shapley (1962) , and it has evolved to

Hi, I tried to do a nested Anova with the attached Data. My response variable is "survivors" and I would like to know the effect of (insect-egg clutch) "size", "position" (of clutch on twig) and "clone" (/plant genotype) on the survival of eggs (due to predation). Each plant was provided with three different sizes of clutches (45,15,5) and had

Dear all, I would like to be able to subset a data.frame in a special way. I will put here an example: Score Name 88 000019_0070 88 000019_0070 87 000019_0070 79 002127_0658 79 002127_0658 77 002127_0658 So, for the above example I would like to have a new data.frame that has only the best "Score" for each

Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I read a text file and create a data frame of only certain parts of the file. For instance, from this text file: =================================================== Matches For Query 0 (108 bases): 000019_0070 =================================================== Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070

Dear all, I would like to know how can I order a data.frame with increasing the dat$Interval (dat$Interval is a factor). There is an example below. Original data.frame: > dat Interval Number_reads 0-100 685 200-300 744 100-200 1082

Dear all, I would like to generate 25 numbers from 1 to 100 but I would like to have some numbers that could be more probable to come out. I was thinking of the function runif: runif(25, 1, 100) , but I don?t know how to give more weight to some numbers. Example: each number from 2 to 10 has the probability of 40% to come out but the probability of each number from 11 to 100 to come out is

Hello, I am trying to run "RCMD check" on a package. It performs OK, with the exception of a single warning: * checking package vignettes in 'inst/doc' ... WARNING Package vignette(s) without corresponding PDF: AnnotationFuncsUserguide.Rnw As I understand the problem, the vignette is not built. However, I have no problems in doing so manually. How do I fix this problem? I

Dear all, I was trying to see how the function 'confint' is defined. Doing > confint function (object, parm, level = 0.95, ...) UseMethod("confint") <environment: namespace:stats> does not really enlighten me. How can I get to see the implementation (I guess it should be possible according to the general philosophy of the R project)? Thanks in advance S??ren

I am trying to build a package binary, and get the message below. Can anyone point me to a solution to that problem. Thanks in advance S?ren .... installing data files installing man source files installing indices Error in load(zfile, envir = envir) : input has been corrupted, with LF replaced by CR Execution halted make[2]: *** [indices] Error 1 make[1]: *** [all] Error 2

Dear all, In S+, there are functions like create.ole.object call.ole.method release.ole.object for communicating with other programs which work as a COM server (on Windows). Is it possible to do something similar in R (I've studied the 'connections' facilities, but they do not seem to work). ========================================== S?ren H?jsgaard, PhD, Senior Scientist