similar to: Problem Using the %in% command

I have 2 files containing data analysed by 2 different methods. I would like to find out which genes appear in both analyses. Can someone show me how to do this? _________________________________________________________________ [[trailing spam removed]] [[alternative HTML version deleted]]

Hey guys, can anyone help? i have a sample table: >table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) >table codon1 codon2 codon3 gene1 4.0 7

I do have a bunch of genes ( nearly ~50000) from the whole genome, which read in genomic ranges A range(gene) can be seem as an observation has three columns chromosome, start and end, like that seqnames start end width strand gene1 chr1 1 5 5 + gene2 chr1 10 15 6 + gene3 chr1 12 17 6 + gene4 chr1 20 25 6 + gene5

Hey guys, if i do a correspondance analysis, e.g.: table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) Library(ca) plot(ca(table)) is there a way that i can see

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

Hi, First my apologies for a non-working piece of code in a previous submission, I have corrected this error. I'm doing is individual based modelling of a pathogen and it's host. The way I've thought of doing this is with two dataframes, one of the pathogen and it's genes and effector genes, and one of the host and it's resistance genes. During the simulation, these things

Hi, maybe someone can help me with this: I have a matrix of genes and values: GeneName Value Abc1 10 Abc2 11 Bbc1 -5 Bbc31 2 Ccd 5 Ccd -2 Ccd 7 Dda 5 Dda 10 ..... ..... Zzz3 -1 I would like to

Dear all, I have a variable that I would like also to use it as a string. The reasons is that I want to collect results from different function to one table.. So when I use the  colnames(mymatrix) <-c(function1.function2,function3) the function1, function2, function3 to be "converted" to simple strings so as  colnames(mymatrix)

Hi I'm storing two functions in a list # creating two function function1 <- function(n) { return(sum(n)) } function2 <- function(n) { return(mean(n)) } #storing the function function3 =c(function1,function2) is it possible to call the stored function and used it ? x=c(10,29) funtion3[1](x) Thanks ----- Thanks in Advance Arun -- View this message in context:

Hi, here comes my problem, say I have the following functions (example case) #------------------------------------------------------------ function1 <- function (x, theta) {a <- theta[1] ( 1 - exp(-theta[2]) ) * theta[3] ) b <- x * theta[1] / theta[3]^2 return( list( a = a, b = b )) } #----------------------------------------------------------- function2<-function (x, theta) {P

Hi, I've looked through the posts but couldn't find a solution to this. I'd be really grateful if someone could help, I'd like to convert a data file of mutual information that is formatted as a matrix:             TF1    TF2    TF3    TF200... Gene1    0.0    0.2    0.2 Gene2    1.4    0.0    2.8 Gene3    0.3    0.6    1.7 Gene6000.... To a list: Gene1    TF1    0.0 Gene1   

hi, folks: i need to transpose the following data: gene tissue patient1 patient2 patient3..... --------------------------------------------- gene1 breast 10 100 1 gene2 breast 20 200 4 gene3 breast 30 50 5 gene4 breast 40 400 9 ................................ to the

Hi all, I have been struggling with this problem for a few days. I have a data table like this: gene rpkm1 diff1 rpkm2 diff2 gene1 23 50 13 120 gene2 111 220 827 1200 gene3 75 998 71 910 And I want to re-format it so that, for each gene, I have a 2x2 contingency table, such as: gene rpkm diff gene1 23 50 gene1 13 120 gene2 111 220 gene2 827

I do have a bunch of genes ( nearly ~50000) from the whole genome, which read in genomic ranges A range(gene) can be seem as an observation has three columns chromosome, start and end, like that seqnames start end width strand gene1 chr1 1 5 5 + gene2 chr1 10 15 6 + gene3 chr1 12 17 6 + gene4 chr1 20 25 6 + gene5

Hey guys, Can anyone help? I did a correspondance analysis and made a plot. I also have a specific list of nodes that i want to find in my plot and want to either color the nodes that appear in my list differently, or put some kind of border around that group of nodes... Would anyone know how to do this? Also, would this post be more relevant here or in the bioconductor forum? -- View this

Dear list members, After a print job is submitted to Samba, from a windows client, the job file is created at /var/spool/samba, and immediately, it 'get's copied to /var/spool/cups, as it's expected, but, and here is the problem, it's also removed from /var/spool/samba although remaining in the to be processed queue in Cups. CUPS finally gets the job printed ok, but

MUJERES EN LA CIMA imagen LIDERAZGO Y EMPODERAMIENTO EMPRESARIAL PARA MUJERES 27 DE NOVIEMBRE 2023 CONFERENCIA VIRTUAL EN VIVO Este evento est? dise?ado para desatar el potencial de liderazgo que cada mujer posee y forjar una trayectoria empresarial redefinida por la excelencia, la innovaci?n y la influencia. Reg?strate Ahora Si el bot?n no funciona o si usted lo prefeire, puede simplemente

Hello Everyone I'd like to know what's the best way to measure syslinux functions duration.I know how to measure overall time (from syslinux start), but is there an easy way to break it down? Thanks,Tal

Hi Everyone, I am trying to find a way to do this in excel to tell me which genes are the most differentially expressed. Sorry, i couldn't find excel forum section in nabble. However, if it is in R it is fine. This is a microarray data, and it has been normalized. According to Dov Stekel in Microarray, i will need to calculate log ratio (control-treatment). Once you have the log ratio,

>Date: Thu, 6 Mar 2008 06:46:07 -0800 (PST) >From: Keizer_71 <christophe.lo@gmail.com> >Subject: [R] Statistical Questions: finding differentially expressed >genes >To: r-help@r-project.org >Message-ID: <15873163.post@talk.nabble.com> >Content-Type: text/plain; charset=us-ascii >Hi Everyone, >I am trying to find a way to do this in excel to tell me which