similar to: Different versions, different results ?

Hello, I am having a some problems getting SSHD to run on the Ipv6 interface. Interface/Ipv6 Address: ipv6.open-systems.org [kevin at satan kevin/xp-0.0.15] 536 $ping6 ipv6.open-systems.org PING6(56=40+8+8 bytes) 3ffe:1200:3028:ff01::cab --> 3ffe:1200:3028:ff01::caa 16 bytes from 3ffe:1200:3028:ff01::caa, icmp_seq=0 hlim=64 time=73.96 ms sshd_config: ListenAddress

Hello everyone, I am trying to "parse" a part of LLVM IR. More exactly, from @.str = private unnamed_addr constant [3 x i8] c"DS\00", section "llvm.metadata" I want to get "DS". It is the single place in the whole bytecode from where I can get it. I have : ... Value *VV = cast<Value>(LD100->getOperand(1)->getOperand(0));

PowerDNS supports CAA records beginning with version 4.0, but the pdns package in EPEL for most recent centos versions is stuck at around version 3.4 (3.4.11 is what I have). Do I have no other choice but to manually compile and maintain my own pdns installation? I prefer to avoid this but I need up-to-date features. Perhaps there is a PowerDNS specific work-around? Maybe the EPEL

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Dear Sirs/Madam, I am a beginner to R, and I am currently working on a data matrix which looks like this: > head(oligo) ko:K00001 ko:K00003 ko:K00005 ko:K00008 ko:K00009 ko:K00010 ko:K00012 AAA 370 631 365 67 164 455 491 KAA 603 1208 170 157 68

Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: > > Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >> So far, I've only been able to filter HTTP. >> >> Do any of you do transparent HTTPS filtering ? Any suggestions, >> advice, caveats, do's and don'ts ? > > After a week of trial and error, transparent HTTPS filtering

I tried to use calcMin with a function that uses a number of ... arguments (all args from resid on) besides the vector of parameters being fit. Same idea as optim, nlm, nlminb for which this form of ... syntax works. But with calcMin I get an error regarding unused arguments. No partial matches to previous arguments that I can see. Anybody know the reason or fix for this?

Hi everyone, If you have experience using Samba < 2.0.7 with AutoCAD 2000/2000i or R14 on a LAN, where the Windows 2000 Professional clients running AutoCAD 2000/2000i are opening .dwg files and XREFS off of the server, particularly if you know tips on tuning Samba's performance so that AutoCAD reports it can't find files on the server or load XREFs, please either post your comments to

On 03/05/18 08:34, Bill Gee wrote: > > On Monday, March 5, 2018 7:23:53 AM CST Leon Fauster wrote: >> Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: >>> Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >>>> So far, I've only been able to filter HTTP. >>>> >>>> Do any of you do transparent HTTPS filtering ?

> Am 05.03.2018 um 15:34 schrieb Bill Gee <bgee at campercaver.net>: > > > On Monday, March 5, 2018 7:23:53 AM CST Leon Fauster wrote: >> Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: >>> Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >>>> So far, I've only been able to filter HTTP. >>>>

Hi, Is this method broken in R? I am using it to find roots of the following function: f(x) = 2.5*exp(-0.5*(2*0.045 - x)) + 2.5*exp(-0.045) + 2.5*exp(-1.5*x) - 100 It is giving an answer of -38.4762403 which is not even close (f(x) = 2.903809e+25 for x=-38.4762403). The answer should be around 0.01-0.1. This function should converge.. Even for a simple function like f(x) = exp(-x) * x, it gives

Dear Frauke, Thank you very much for taking the time to respond. You explanation was very helpful, and I now have that part figured out! Best Wishes, Dan Frauke Message: 3 Date: Mon, 12 Oct 2020 08:33:44 +0200 (CEST) From: =?UTF-8?Q?Frauke_G=C3=BCnther?= <guenther at leibniz-bips.de> To: "r-help at r-project.org" <r-help at r-project.org> Cc: William Michels <wjm1

--On Friday, December 08, 2017 7:54 PM +0000 MRob <mrobti at insiberia.net> wrote: > PowerDNS supports CAA records beginning with version 4.0, but the pdns > package in EPEL for most recent centos versions is stuck at around > version 3.4 (3.4.11 is what I have). > > Do I have no other choice but to manually compile and maintain my own > pdns installation? I prefer to

Hi I have been able to setup postfix and dovecot using postgres as the backend store with virtual user maps on Ubuntu 12.04 LTS Server. I have been following instructions from here: http://wiki2.dovecot.org/HowTo/DovecotPostgresql I haven't setup postfix to use saslauthd and PAM, instead I am using dovecot for SASL authentication. Rest of the table structures and query files are the same as

Dear all, the exclude and constant.weights options are used as follows: exclude: A matrix with n rows and 3 columns will exclude n weights. The the first column refers to the layer, the second column to the input neuron and the third column to the output neuron of the weight. constant.weights: A vector specifying the values of the weights that are excluded from the training process and treated

This is really a feature of SQL, not R. SQL requires that you double quote column names that start with numbers, include spaces, etc., or that are SQL key words. E.g., > d <- data.frame(Order=c("sit","stay","heel"), Where=c("here","there","there"), From=c("me","me","you")) >

I''ve been banging my head against this for quite some time and can''t figure out what is going on. I''m doing up a web site based on Typo and adding in some custom controllers. I''m running Typo from trunk, so it''s using the version of rails in vendor/rails. Everything is going smoothly...until now. I have one model that JUST. WON''T. WORK.

Hi everybody, I''m experimenting with Rails and AngularJs (as unembedded client) and decided to upload to a public github repository my efforts. Of course, everything is just a toy application I use to experiment and test on various stuff (there''s absolutely no production ready nor TDD/BDD backed code). As of now a very basic login/signup feature is implemented and

Hi Dr. Snow, & R-helpers, Thank you for your reply! I hadn't heard of the {microbenchmark} package & was excited to try it! Thank you for the suggestion! I did check the reference source for which() beforehand, which included the statement to remove NAa, and I didn't have any missing values or NAs: sum(is.na(dat$gender2)) sum(is.na(dat$gender)) sum(is.na(dat$y)) [1] 0 [1] 0 [1]

Follow the code :- class Sample def bar p method(__method__).receiver # only `self` would do the trick. end end n1=Sample.new # => #<Sample:0x13bc648> n2=Sample.new # => #<Sample:0x13bc630> n1.bar # => #<Sample:0x13bc648> n2.bar # => #<Sample:0x13bc630> But this is my try. I am looking for any method is available in Ruby,into which say if I pas