similar to: Job for Ruby On Rails

We are a very small company and moved from WinTel environment to Linux. Killed the WinTel file/print server and implemented SAMBA om Red Hat 7.2. I have some users that need to print to a RICOH Aficio 4106 printer. When I go through the sequence to add printer ...... it appears to install, but the people cannot print. Can anyone walk me through steps as I am novice...... and I do not want to go

Hi all, I am having a problem indexing one of my mailboxes using the solr fts backend in dovecot 2.1.12 For many mailboxes it works just fine, but on one mailbox I currently always get a panic. solr setup: Java: icedtea 6.1.11.5 Solr: 3.6.2 running in tomcat 7.0.32 Command to reproduce error: doveadm index -u my at user badmailbox I already noticed that there have been some solr backend fixes

Hi! I use dovecot 2.1.7 on Ubuntu 12.10 with fts_solr und decode2text.sh for indexing attachments. This works great in general. Just for one user there is a problem with an unknown bad attachment. I run "doveadm index -A '*'". After a while I receive: doveadm(xyz): Error: fts_solr: Invalid XML input at line 1: mismatched tag doveadm(xyz): Panic: file solr-connection.c: line

My goal is simple: calcuate GC content of each sequence in a list of nucleotide sequences. I have figured out how to vectorize, but all my attempts at memoization failed. Can you show me how to properly memoize my function? There is a StackOverflow post on the subject of memoization, but it does not help me: http://stackoverflow.com/questions/7262485/options-for-caching-memoization-hashing-in-r

Dear R-helpers, I would like to export hierarchical clusters e.g. fit <- hclust(d, method="ward") in the newick format write(hc2Newick(fit),file='hclust.newick') Searching for a possibility I found this solution in the package ctc (http://www.bioconductor.org/packages/bioc/html/ctc.html). However, neither from this site nor via CRAN it is possible to install the package.

Hi, Is there a simple command for computing the standard error of a combination of parameter estimates in a GLM? For example: riskdata$age1 <- riskdata$age riskdata$age2 <- ifelse(riskdata$age<67,0,riskdata$age-67) model <- glm(death~age1+age2+ldl, data=riskdata,family=binomial(link=logit)) And we want to find the standard error of the partial linear predictor for

Hi, I'm doing hierarchical clustering, and want to export my dendrogram to a tree-viewing/editing software. I can do this by converting the data to Newick format (hc2Newick in ctc package), but I can't get branch lengths to show in the resulting phylogram. I figured it might help to convert my hclust object into a phylo object (as.phylo in ape package), but the following lines give me

Hey all, I am running a Asterisk 1.2.9.1 with Sangoma A101 card, newest firmware, configured with a help from Sangoma Tech Support, running fine. It is connected to a PRI circuit split from Cisco MC 3810, which in turn is connected to a Converged T from CTC Communications. While Asterisk works fine and I can call in/out on my BV account, I am only able to dial in through CTC. I have spent

Dear all, The CRUK MI have multiple positions in and around bioinformatics, biostatistics and computational biology. These range from HPC and mathematical programming, through biostatistics and biomarkers, to computational biology and bioinformatics. Focuses include single cell genomics and personalised medicine in lung and prostate cancer. For full details, please visit our website at:

Puppet 3.3.1 // CentOS release 6.4 (Final) rpm -qa | grep puppet puppetlabs-release-6-7.noarch puppet-3.1.1-1.el6.noarch puppetdb-1.3.0-1.el6.noarch puppet-server-3.1.1-1.el6.noarch puppetdb-terminus-1.3.0-1.el6.noarch Installed from yum packages: Running Transaction Installing : puppetdb-1.3.0-1.el6.noarch

This is related to the "No space on OCFS2 volume" error discussed here this past Sep/Oct. Our Oracle support rep pointed us to Metalink note #1232702.1 and suggested we should script something up to periodically check the free contiguous blocks in the group chains for the volume in question. Reading the note, I get how to get Clusters per Group X Bits per Cluster from the "stat

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

I have (below) an attempt at an R script to find the limit distribution of a continuous-time Markov process, using the formulae outlined at http://www.uwm.edu/~ziyu/ctc.pdf, page 5. First, is there a better exposition of a practical algorithm for doing this? I have not found an R package that does this specifically, nor anything on the web. Second, the script below will give the right

hi, I have a Win2k with a shared folder named with a lot of hungarian characters. I tried to smbmount this folder, but this doesn't work: #in smb.conf: character set =3D ISO8859-2 client code page =3D 852 valid chars =3D =E1:=C1 The foldername isn't correct. Can anyone help me? I hope you understand what I mean. hi trezsi ------------------------------------------ (c)CTC, =E9s a

[This is really just a post-it note to myself, but I'm cc'ing it to wine-users in case it's useful to others.] I was told recently that a company wanted to migrate some desktops to Linux, but ended up not being able to because they had a web-based application that 1) required IE, and 2) used an ActiveX control that implemented a 5250 terminal emulator to connect to a mainframe

Hi Everyone, I'm trying to get squid + wccp on a Centos 7 box working with a Cisco router. I've done this before several times using Centos 6 and iptables, but never on Centos 7 with firewalld. I've searched far and wide for clear, concise instructions on how to do what I want in Centos 7. I've pieced together what I've found to come up with what I thought should work.

Hello samba gurus I have used samba1.9.18.p4 since jan/1998. I have FreBSD 2.2.6 and samba1.9.18p4 worked just fine. I read in bugtraq that a new version of samba has been released and I thought in upgrade to samba1.9.18.p7 Well I did the same things that I did when I compiled samba1.9.18.p4 1.Edit the Makefile ( I edit the same lines as samba1.9.18.p4) 2.make 3.make installbin Everything

On Mon, 1 Jun 1998 samba@samba.anu.edu.au wrote: > > Date: Sat, 30 May 1998 23:54:25 +0100 > From: Jonathan Peterson <jon@amxstudios.com> > To: samba@samba.anu.edu.au > Subject: Very slow writes to Samba server > Message-ID: <3.0.1.32.19980530235425.006ff4c0@amxstudios.com> > > Hi, > > I'm using the latest samba with encrypted passwords, on a

I am running samba on HP-UX 10.20 with clients on Win95. I have two questions. Where can I get more information on the force user parameter? I am using it but am unable to get it to properly prompt for a password when mapping it. Next question deals with log messages in log.nmb. Where are these two messages coming from and how do I get rid of them? --IP address changed to XXX.XX.XX.XX

Is anyone else using the AMI with res_fax_spandsp.so for real-time status? I am working on migrating a FAX application from res_fax_digium.so to res_fax_spandsp.so. I have noticed that the spandsp module generates far fewer AMI status events than the Digium module and the generated events contain less information. For example when sending a fax there is no longer an event for every page. There