Displaying 20 results from an estimated 20000 matches similar to: "Win2K client can't create directories"
2001 Mar 15
2
Win2K printing Problems with Samba
Hi everyone !
i have some trouble printing from Win2K to Samba Server :
My configuration
Server Samba :
Mandrake Linux 7.2
Samba 2.0.7
CUPS
Configured Printer on Parallel Port Kyocera FS 3750 with CUPS
Client : Win2K PRO
driver Apple LaserWriter
When I send a request of print , my printer prints three pages :
the first have a line like this: "%%[ProductName : GNU postscript] %%"
2001 Mar 15
1
AW: samba on win2k
If you haven't deactivated password encryption on win2k (by changing the registry) you should make sure that "encrypt passwords = Yes" is set in your smb.conf.
-----Urspr?ngliche Nachricht-----
Von: Santosh Cheler [mailto:toshck@yahoo.com]
Gesendet am: Donnerstag, 15. M?rz 2001 10:04
An: samba@lists.samba.org
Betreff: samba on win2k
I setup samba on rh6.2, and when i try to access
2001 Mar 14
2
Win2k disconnects mapped samba shares
Hello,
I stepped through the archives of this list, but could not find a
thread dealing with exactly this problem we are experiencing here.
Server HP-UX 10.20 Samba 2.0.6
security = domain
deadtime = 500 ... that should be enough
The win2k clients map a drive and everything is working fine.
after a period of inactivity (about half an hour) win2k somehow disconnects
the mapped drive
and marks
2001 Mar 24
1
Data Corruption with Win2K clients & ACT 2000 database
Greetings,
I read with interest the few posts in the archives discussing problems I
have recently encountered with data corruption of an ACT 2000 database
residing on a Samba 2.07 share, SuSE Linux 7.1 (2.2.28 kernel), with about
25 Win2K clients.
I did not, however, see any apparent resolution to this major problem - I
either am going to have to rebuild from scratch my current Win2K Server, or
2001 Mar 13
2
Samba 2.2 CVS
Sure thing:
cvs -d :pserver:cvs@pserver.samba.org:/cvsroot login
<password is cvs >
cvs -z5 -d :pserver:cvs@pserver.samba.org:/cvsroot co -r SAMBA_2_2 samba
this will grab samba_2_2 and place it in a directory lableled samba.
leaving out the SAMBA_2_2 grabs HEAD.
you can get other modules as follows:
SAMBA_2_2
HEAD
APPLIANCE_HEAD
APPLIANCE_TNG
there are others but I haven't tried
2001 Mar 05
2
Samba, NT4 and W2K trust/authentication problem.
Hi all,
Set-up:
Local NT4-RESOURCE domain which the Samba server is a member off.
One NT4-ADMIN domain with users accounts and one W2K domain
with some other user accounts. A one way trust from NT4-ADMIN
to NT4-RESOURCE and a one way trust from W2K to NT4-RESOURCE.
Samba version 2.0.7 running on Solaris 2.6.
According to the NT admins, the W2K domain is in native mode,
but they still use
2012 Dec 18
3
[LLVMdev] Can't compile Dragonegg
Hi,
I'm trying to compile release 3.2 of DragonEgg (checked out from
http://llvm.org/svn/llvm-project/dragonegg/branches/release_32. I'm at
revision 170458), under Ubuntu (Ubuntu 12.04.1 LTS (GNU/Linux
2.6.39-gcg-20121018 x86_64)) and I get the following error.
tmroeder at myubuntu:~/src/dragonegg$ make
Compiling utils/TargetInfo.cpp
Linking TargetInfo
Compiling Aliasing.cpp
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2012 Dec 18
0
[LLVMdev] Can't compile Dragonegg
Hi Tom,
DragonEgg depends on GCC's and LLVM's internal headers, auto-host.h is
one of them. Try to add GCC and LLVM_CONFIG with your make command as
described here http://dragonegg.llvm.org/ in section "Getting it".
Best,
- Dima.
On 12/18/2012 10:24 PM, Tom Roeder wrote:
> Hi,
>
> I'm trying to compile release 3.2 of DragonEgg (checked out from
>
2001 Mar 27
2
smbclient -b parameter
I've got problems getting files from a win2000 server using smbclient
(see subject "SMBClient & Windows 2000"). I've tried using the -b
parameter (documented in the online man pages) to change the buffersize
in case that might be the problem but the smbclient I'm running doesn't
recognise it. I've installed 2.0.7 on Compaq Tru64, smbclient declares
itself as
2003 Mar 29
1
Samba from win2k client - "incorrect password or unknown username" error
Hi,
I've got an annoying little problem with Samba and Win2k. I installed a Win2k
Pro client on the network and set it to use plain text passwords and join the
workgroup.
The username and password of the user on the win2k box are the same as the
account in /etc/passwd on the linux box. But after logging in, when trying to
reconnect the mapped drives the windows box says:
"Incorrect
2001 Mar 26
2
2.2 Alpha3 - how stable is it?
Hi all,
I was wondering what the feeling was of those on this list as to how stable
this alpha is? Is it useable in a production environment for basic file
sharing of a shared database (ACT)?
The reason I am asking is I am having major file corruption issues with
Win2K clients using 2.07, and if the suggestions already made do not fix the
problem, I would be willing to try it, if it is
2012 Dec 19
2
[LLVMdev] Can't compile Dragonegg
Hi,
I suggest add the id attribute for each <h2> tag in www/index.html. Thus we
can refer to the "Getting it" section in the dragonegg homepage page (the
only web page) by simply the given URL:
http://dragonegg.llvm.org#GettingIt
Regards.
On Wed, Dec 19, 2012 at 6:32 AM, Dmitry Mikushin <dmitry at kernelgen.org>wrote:
> Hi Tom,
>
> DragonEgg depends on GCC's
2005 Mar 04
1
R-2.01 and RSPerl-0.6.2
Hi,
I am somewhat new to R and RSPerl, but I think this particular problem
has to do with RSPerl and so I am not sure if this is the right forum
to ask for help. Nevertheless I am quite sure that many of you would
have used RSPerl with R.
My hardware platform is a Sun/Solaris V440 server running Solaris 9
operating system I use the gcc-3.4.0 compiler to compile R without any
problems. My
2003 Apr 27
3
general question - help creating a login script to pass a RPC to create symblinks from win2k on linux
Hi,
I am new to samba and Linux and need some help coming up with a solution to
a nerve racking problem.
Here is what we are trying to do.
Users log into an NT environment (accessing shares via samba running on
Linux/Aix).
The user should only see and have access to the share(s) he/she has been
assigned to. Similar to Novell "map root" or symbolic links.
Our issue is try to
1997 Aug 04
23
smbpasswd
I have finally managed to compile and install samba 1.9.7alpha5 with
des, shadow passwords and PAM.
I have a new problem now.
my 95 clients when set to user level access control and try sharing
something give this error.
"You cannot view a list of users at this time. Please try again later."
I belive this is because the rights on the file smbpasswd [the file
containing the passwords]
2012 Dec 19
0
[LLVMdev] Can't compile Dragonegg
Hi Mingliang LIU,
> I suggest add the id attribute for each <h2> tag in www/index.html. Thus we can
> refer to the "Getting it" section in the dragonegg homepage page (the only web
> page) by simply the given URL:
> http://dragonegg.llvm.org#GettingIt
this already works:
http://dragonegg.llvm.org/#gettingrelease
But maybe could be done better or more consistently?
2012 Aug 29
1
augeas and cron.allow
Hi.
I am having a few problems with augeas and need some help.
What I am trying to use is augeas to update the cron.allow file. I can get augeas to add the required name but I am having problems with getting it to add the name once.
augeas { "check_mk_cron.allow" :
context => "/files/etc/cron.allow",
# changes => "set
2004 Mar 05
1
Samba + Win2k
How can i get a trust relationship betwen Samba Domain and Win2k ?
I?ve tried many ways like, change win2k register, changig some security
directives, etc.
The win2k is added at Samba Domain like this
useradd -g MYGROUP -d /dev/null -s /bin/false WIN2k$
smbpasswd -a -m WIN2K$
Is there other way??
Thanks
2002 Nov 19
2
Problem with win2k and winXP
Hello,
I have a network, where users want to login with their same username from
Windows 2000 and from Windows XP on a samba PDC.
When the machines logon, I can see the OS in the logfile of the machine on
my server, but i cannot use different profiles for Win2k and WinXP, because
the %a in smb.conf always gives back Win2k.
The profiles of win2k and winXP aren't compatible, so i can't just