similar to: display memory usage

Hi, I'm trying to assign iterative names to variable, but all my attempts have failed. I have a loop, and for every iteration, I need to create a variable, and I'd like to name them iteratively, such as: for(i in 1:10) { x_i <- c(values) } I need it to return ten variables: x_1, x_2, ..., x_10 How can I do it? Thank you very much! Beatriz -- View this message in context:

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi all, I'm trying to read a data set into R, but the file is messy, so I have to do it partially. The whole data is in a .txt file, and the values are separated by a space. So far ok. The problem is that in this file, not all the lines have the same number of elements, and the reading stops. And I loose the reading of the previous lines. ex. of data set: 11 12 13 21 22 23 31 32

Hola Javier, si, y es un factor de Y. Pero ya entendí lo que tenía mal, me falta convertir Nt a valores de geodata antes de hacer el plot, es decir: date<-as.geodata(Nt) plot.geodata(date) Con relación a la actualización de mi versión de R, no me he animado porque he tenido problemas con paquetes que no tienen las actualizaciones y no me corren bien. Gracias y saludos Beatriz 2013/8/6

Hola, Beatriz: Buscando en ?order derivé en arrange, y al final es como resolví: arrange(my.df, col1, desc(col2)) Con order no conseguía el orden descendente, pues me daba error al intentar hacer order(-my.df$col1) Gracias. Eva ________________________________ De: Beatriz Martínez <mtnezb@gmail.com> CC: r-help-es <r-help-es@r-project.org> Enviado: Martes 16 de julio de 2013

Hi I have the following barchart to which I want to add error bars. library(lattice) barchart(Change~fTreat,groups=Process,change, auto.key=list(points=FALSE,rectangles=TRUE), panel=function(x, y,...){ panel.barchart(x,y,origin = 0,...); panel.abline(h=0,col="black",...); } ) I have tried

I making an xyplot and the y label is too long and needs to be in two rows, but when I brake it there is a huge gap between the last text string and the expression, and I can't get rid of it. Any ideas? Data: structure(list(Temp = c(8L, 8L, 8L, 8L, 8L, 8L, 12L, 12L, 12L, 12L, 12L, 12L), CO2 = c(380L, 380L, 380L, 750L, 750L, 750L, 380L, 380L, 380L, 750L, 750L, 750L), Treat = structure(c(3L,

Perfecto! muchas gracias Carlos; la verdad que estuve un buen rato intentándolo, pero aún no comprendo la estructura de lattice, así que modificaba cosas un poco al tuntun. Tengo otra cuestión un poco más controvertida, no sé si este será el foro adecuado para proponerla o supondrá un debate innecesario.... Como os decía, acabo de iniciarme en R, y estoy explorando las opciones de visualización.

Hola Beatriz, Si me pasas el *.md lo subo a un Dropbox y si no es muy grande lo subo a R-Hispano (linkándolo a la agenda).... Saludos, Carlos. El 29 de octubre de 2013 15:56, Gregorio R. Serrano <grserrano@ccee.ucm.es>escribió: > Hola. > > ¿Nos podemos descargar el material de alguna parte antes de ir? > > Gracias > > > El 29 de octubre de 2013 14:58, Beatriz

Hello, I made a "wine" upgrade from 2003121 to 20040914. I then installed a program "EasyBridge" that worked perfect with the 2003121 version. The installation was without any problems, and at the end of the installation the program started automatically, also withouth problems. But when I later on recall the program with "wine EasyBridge.exe" I get the

Buenas tardes a todos: No sé si alguno de vosotros sabe si con R es posible buscar una palabra en una web (por ejemplo, buscar "Alicante" en www.lasprovincias.es) y que, cada vez que lo encuentre, vaya almacenado las urls en un data.frame gracias de antemano! -- Beatriz Martínez [[alternative HTML version deleted]]

Hi, i have a vector filled with names: [1] Alvaro Adela ... [25] Beatriz Berta ... ... [100000] ... I would like to drop last character in every name. I use the next program: for (i in 1:100000) { ? ? ? ? ? ? ? ? ? ? ? ? ? largo <- nchar(names[i]-1) ? ? ? ? ? ? ? ? ? ? ? ? ? names[i] <- substring (names[i],1,largo] ? ? ? ? ? ? ? ? ? ? ? ? ?} Is another and faster way of do it? Thanks,

Hola a todos, estoy trabajando con dos archivos csv. En uno de ellos extraigo dos variables (que son coordenadas), del segundo archivo extraigo otra variable que transformo. Con estas tres variables construyo un data.frame (las tres variables tienen la misma longitud). Hasta ahí todo bien, solo que cuando quiero usar este data.frame para hacer un plot.geodata me marca el siguiente error Error en

Hi I am running a PC under Linux SuSE 7.2 with kernel 2.4.18, self compiled. I changed some days ago the partition of my second HD from ext2 to ext3 with the help of tune2fs -j /dev/hdb2 and everything was running OK. Today, I had a problem with a frozen display and I had to reboot the box cold. During the corresponding forced check I got the following messages: Quote --------- /dev/hdb2: reading

Hello Thanks to Beatriz Botero I know such thing should work nice. But I try some combinations and always get result as on pictures: http://www.janek.gwozdzie.dhs.org/pliki/screenbad.png while it shoud be http://www.janek.gwozdzie.dhs.org/pliki/screengood.png I would prefer fake-windows but tried also with real ones. My system is slackware-current with kernel 2.6.9-rc1 but then I tried knoppix 3.6

Hallo all, we are completly new to this list and also to wine, so sorry if the question is too simple. We are trying to install and work with wine, withouth results: err:win32:PELoadLibraryEXA can't load C:\WINNT\system32/comdlg32.dll although the file comdlg32.dll exists in the directory. This is one of three messages I cannot copy from the terminal Question: our Windows partition is

Hola a todos: efectivamente, esas son las librerias que convine tener instaladas. Llevaré los datos que utilizaremos en un pendrive (por si acaso falla la wifi) y también el *.md del código para poder seguir la demo sin escribir todo el código! Para esto, yo creo que lo mejor es abrir el *.md con R Studio. Esta tarde nos vemos! -- Beatriz Martínez @_bmartinez_

Hello, I have done a scatterplot and now would like to add its regression line but it does not show. Below, the code I have used. lm3 <- lm(data$S_pH_KCl2.5_BCx~data$B_OleicoPF_BCx_per) plot(data$S_pH_KCl2.5_BCx, data$B_OleicoPF_BCx_per) abline(lm3) I have been able to do the complete operation using the software STATISTICA but it would be great to do it with R. If you require more details

Hola a todos: soy nueva en R así que es posible que la pregunta sea simple, pero no encuentro la solución. El caso, quiero hacer un gráfico de barras sencillito, pero con una linea horizontal que represente la media. Pues bien, si hago el gráfico sin aplicar la linea, no hay problema: ----- barchart(web[,2] ~ web[,1], col="#2C575D", ylab=colnames(web)[2],

Gracias Beatriz, efectivamente, lo que indicas en tu ejemplo es lo que obtengo al final de mi proceso. En todo caso pruebo tu opción con mis datos, si es como imagino seguro que es más rápida de montar y más elegante que tratar el resultado de un sink() (recuerdo que en su momento lo intenté con fotify pero no supe bien como atacarlo, no conocía el enlace que me mandas, por tanto lo pruebo de