similar to: strange h323 delay issue

Displaying 20 results from an estimated 1000 matches similar to: "strange h323 delay issue"

2006 Nov 23
1
asterisk 1.4 chan_h323, help please...
Hi, My configuration is SipPhone<-->*1<--->*2. My asterisk version is 1.4beta3. I installed pwlib,openh323,chan_h323. When i call from SipPhone--(SIP)-->asterisk1---(H323)-->asterisk2, there is no audio. Using 'rtp debug', I can see that rtp packets are being received. Rtp packets are being exchanged. I also tested chan_ooh323, but to fail. Can anyone recommand best
2003 Nov 27
6
Help for oh323
Hi Friends, Hope you would help me out here, I have searched the asterisk user list for hours and also read the readme and test files that comes with the driver. I need a very simple scenario. I have SIP clients and want to use oh323 to dial out to PSTN using a h323 gateway. a)If I set the extention.conf like this: exten => _87.,1,Dial(OH323/16.52.153.206) oh323 dials out (I can ring a
2003 Jul 10
2
OH323 + G729 + Go2Call
hi .. i've just installed and licensed an instance of the G729 codec. I am trying to connect through asterisk to Go2Call server .. According to their info it involves dialling extension 729 on voip01.go2call.com, to get the IVR. my extensions.conf shows : exten => s,2,Dial(OH323/h323:729@216.52.153.206) which I think is correct, I have G729 enabled in the OH323.conf file and it seems to
2004 Mar 17
2
Installing Samba
Hi I am trying to install Samba on a QNX 4.24 system. When we run the make file we get an error : compiling server.c make:cc:command not found make: *** [server.o] error 127 Can you help with this! Lucille Shears Systems Analyst CCG/DFO shearsl@dfo-mpo.gc.ca (709) 772-3131 cell (685-1512)
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2005 May 16
1
Always Ringing
Hi all, I am using chan_h323 from Asterisk CVS to interconnect with GNUGK v2.2.2. Then I made call from a H323 EP, thru GNUGK, to SIP EP on Asterisk. However, I only heard ringing when the call was answered on SIP side. Below is the debug from chan_h323. Any help is welcome. Thanks. *CLI> == New H.323 Connection created. -- Setting up Call -- Call token:
2004 May 04
0
[LLVMdev] FYI: ccg
Hi LLVMers, For your interest, I recently came across the ccg library "dynamic code generation for C and C++". --> http://www-sor.inria.fr/projects/vvm/realizations/ccg/ccg.html It seems to share some points with LLVM. -- Sébastien
2005 Feb 14
0
H323 no sound
Could you help me with this problem? When I call H323 gateway there is no sound in both ways. Here is h323 debug: ----- begin ------------------------ -- Executing Dial("SIP/msn-6297", "H323/73952389512@peer:1720") in new stack Allowed Codecs: Table: G.729A{sw} <1> G.729{sw} <2> G.711-uLaw-64k <3> G.711-ALaw-64k <4>
2005 Jan 28
3
reason 24 (Call ended with Q.931 cause)
Hi Michael and Everyone I'm trying to connect Asterisk to a CISCO AS5350 using oh323 and I'm getting this error "reason 24 (Call ended with Q.931 cause)" I've checked the Asterisk wiki and several other resources. Please can anyone give me a hint on what the problem is I reach my wits end. Thanks Tola my config and debug Configuration of OpenH323 channel driver
2004 Jul 22
1
Sip -> H323 using oh323 and G729
Hi All, I have set up a box that will be used as follows: SIP Phone ----> Asterisk ----> Cisco H323 VoIP Server 192.168.1.5 192.168.1.50 192.168.1.80 Asterisk is running the latest CVS and oh323 driver. The SIP phone is a Grandstream Budgetone 100. I have everything setup and running with G.711 ALAW and ULAW and i'm able to make calls through
2007 Aug 08
3
Cannot start workers in production mode
I have a job that I am starting from a Rails controller in production mode using MiddleMan: MiddleMan.new_worker(:class => :import_ccg_category_worker, :args => { :category_id => @category.id, :remote_category_id => params[:remote_category_id], :description => "Importing CCG products for #{@ category.name}" }) Both of the category ID variables are just basic integers. I
2005 May 24
0
H323 integrated Asterisk support
Hi all, I used oh323 support from inaccess. It work very well. I would like to test h323 integrated support. This my problem when I test it : I cannot heard any thing in both way. The test is : SIP --> Asterisk --> H323 This is th debug trace from h.323 : -- Executing Dial("SIP/someaccount", "H323/0033172897104@somehost") in new stack
2009 Jul 06
1
TOSHARG-DomainMember.xml translate finish and some bug found
Now, TOSHARG-DomainMember.xml translate to Japanese finished. and Some bug found. <procedure> <title>Server Manager Account Machine Account Management</title> -------Domain? <step><para> From the menu select <guimenu>Computer</guimenu>. </para></step> When the user elects to make the
2009 May 06
0
problems in h323 channels
Hi, all! when my h323 phone dial in Asterisk system, i can hear nothing. and the following is the log slice i picked from /var/log/asterisk/full. ps: i am using red hat AS5 kernel 2.6.18-53.el5,Asterisk-1.4.24.1, pwlib_v1_11_0, openh323_v1_19_0_1. Best Regards! 81948 [May 6 10:07:34] VERBOSE[11579] logger.c: -- Remote UNIX connection 81949 [May 6 10:07:51] VERBOSE[29627] logger.c:
2005 Jul 03
0
H323 with GSM codec is not working
Hello, I'm trying to use the GSM codec with Nufone H323 but it's not working. Does somebody has some idea? Have I missed something? Thanks!! Celso Fassoni Some additional info: (I'm using CVS-HEAD - downloaded today) monkey:~# cat /etc/asterisk/h323.conf [general] port = 1720 bindaddr = 192.168.0.100 ; this SHALL contain a single, valid IP address for this machine
2007 Jan 26
1
Using Windows API functions in R
Somehow autofilter doesn't allow this message to be posted, will try another time. -----Original Message----- From: Yuri Volchik <volchik2000 at list.ru> To: r-devel at r-project.org Date: Thu, 25 Jan 2007 22:27:13 +0000 Subject: Using Windows API functions in R > > Hi to all. > > In programming one application i have to "press" button to have > application
2005 Jan 27
0
Problem with OpenPhone->Asterisk
Hello all, I just installed Asterisk with H323 support (chan_h323 from Jeremy McNamara). But experience problem while connecting OpenPhone to Asterisk Here is h.323 trace: 5:37.444 H323 Listener:9c86de0 transports.cxx(1504) H323TCP Started connection: host=10.120.160.15:3172, if=10.120.160.99:1720, handle=27 5:37.444 H225 Answer:9cc1250 transports.cxx(564) H225
2007 Sep 02
4
IMAP: Disconnected: BUG: Unknown internal error (Dovecot 1.0.3)
Hi, I am getting the following error in the server mail logfile: > Sep 2 18:39:44 h648123 dovecot: IMAP(<account>)(<PID>): Disconnected: BUG: Unknown internal error (mail_debug is on, but there is not really much context for this in the log file, ie. no log events for several minutes, and then it appears, all of a sudden). On the client side, it looks like this (with some
2008 Aug 28
1
ADS Trouble authorizing users.
Hi all, I've set up a CentOS machine with samba version 3.0.28-1.el5_2.1 to join a Windows 2003 ADS. Everything seemed to go fine while joining the domain: [root@mailserver ~]# net ads join -U administrator administrator's password: Using short domain name -- MYDOMAIN Joined 'MAILSERVER' to realm 'MYDOMAIN.LOCAL' The trouble I'm having is authorizing users. When
2003 Sep 15
1
winbindd using FQDN domain name now?
As of RC3 and RC4, I've noticed that winbindd's wb_getpwuid function is using the form <FQDN-domain><winbind-seperator><username>, and before, it was simply <NetBIOS-domain><winbind-seperator><username>. The net effect of what I'm seeing is that users which have a UNIX account locally on the samba box and also a domain account are being