Displaying 20 results from an estimated 1000 matches similar to: "strange h323 delay issue"
2006 Nov 23
1
asterisk 1.4 chan_h323, help please...
Hi,
My configuration is SipPhone<-->*1<--->*2.
My asterisk version is 1.4beta3.
I installed pwlib,openh323,chan_h323.
When i call from
SipPhone--(SIP)-->asterisk1---(H323)-->asterisk2,
there is no audio.
Using 'rtp debug', I can see that rtp packets are
being received.
Rtp packets are being exchanged.
I also tested chan_ooh323, but to fail.
Can anyone recommand best
2003 Nov 27
6
Help for oh323
Hi Friends,
Hope you would help me out here, I have searched the asterisk
user list for hours and also read the readme and test files that
comes with the driver. I need a very simple scenario. I have SIP
clients and want to use oh323 to dial out to PSTN using a h323 gateway.
a)If I set the extention.conf like this:
exten => _87.,1,Dial(OH323/16.52.153.206)
oh323 dials out (I can ring a
2003 Jul 10
2
OH323 + G729 + Go2Call
hi ..
i've just installed and licensed an instance of the G729 codec.
I am trying to connect through asterisk to Go2Call server ..
According to their info it involves dialling extension 729 on
voip01.go2call.com, to get the IVR.
my extensions.conf shows :
exten => s,2,Dial(OH323/h323:729@216.52.153.206)
which I think is correct, I have G729 enabled in the OH323.conf
file and it seems to
2004 Mar 17
2
Installing Samba
Hi
I am trying to install Samba on a QNX 4.24 system. When we run the make
file we get an error :
compiling server.c
make:cc:command not found
make: *** [server.o] error 127
Can you help with this!
Lucille Shears
Systems Analyst
CCG/DFO
shearsl@dfo-mpo.gc.ca
(709) 772-3131
cell (685-1512)
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2005 May 16
1
Always Ringing
Hi all,
I am using chan_h323 from Asterisk CVS to interconnect with GNUGK
v2.2.2. Then I made call from a H323 EP, thru GNUGK, to SIP EP on
Asterisk. However, I only heard ringing when the call was answered on
SIP side. Below is the debug from chan_h323. Any help is welcome.
Thanks.
*CLI> == New H.323 Connection created.
-- Setting up Call
-- Call token:
2004 May 04
0
[LLVMdev] FYI: ccg
Hi LLVMers,
For your interest, I recently came across the ccg library "dynamic code
generation for C and C++".
--> http://www-sor.inria.fr/projects/vvm/realizations/ccg/ccg.html
It seems to share some points with LLVM.
-- Sébastien
2005 Feb 14
0
H323 no sound
Could you help me with this problem? When I call H323 gateway there is no
sound in both ways.
Here is h323 debug:
----- begin ------------------------
-- Executing Dial("SIP/msn-6297", "H323/73952389512@peer:1720") in new
stack
Allowed Codecs:
Table:
G.729A{sw} <1>
G.729{sw} <2>
G.711-uLaw-64k <3>
G.711-ALaw-64k <4>
2005 Jan 28
3
reason 24 (Call ended with Q.931 cause)
Hi Michael and Everyone
I'm trying to connect Asterisk to a CISCO AS5350 using oh323 and I'm getting
this error
"reason 24 (Call ended with Q.931 cause)"
I've checked the Asterisk wiki and several other resources. Please can
anyone give me a hint on what the problem is I reach my wits end. Thanks
Tola
my config and debug
Configuration of OpenH323 channel driver
2004 Jul 22
1
Sip -> H323 using oh323 and G729
Hi All,
I have set up a box that will be used as follows:
SIP Phone ----> Asterisk ----> Cisco H323 VoIP Server
192.168.1.5 192.168.1.50 192.168.1.80
Asterisk is running the latest CVS and oh323 driver.
The SIP phone is a Grandstream Budgetone 100.
I have everything setup and running with G.711 ALAW and ULAW and i'm able
to make calls through
2007 Aug 08
3
Cannot start workers in production mode
I have a job that I am starting from a Rails controller in production mode
using MiddleMan:
MiddleMan.new_worker(:class => :import_ccg_category_worker, :args => {
:category_id => @category.id, :remote_category_id =>
params[:remote_category_id], :description => "Importing CCG products for #{@
category.name}" })
Both of the category ID variables are just basic integers. I
2005 May 24
0
H323 integrated Asterisk support
Hi all,
I used oh323 support from inaccess. It work very well.
I would like to test h323 integrated support.
This my problem when I test it :
I cannot heard any thing in both way.
The test is : SIP --> Asterisk --> H323
This is th debug trace from h.323 :
-- Executing Dial("SIP/someaccount", "H323/0033172897104@somehost") in
new stack
2009 Jul 06
1
TOSHARG-DomainMember.xml translate finish and some bug found
Now, TOSHARG-DomainMember.xml translate to Japanese finished.
and Some bug found.
<procedure>
<title>Server Manager Account Machine Account Management</title>
-------Domain?
<step><para>
From the menu select <guimenu>Computer</guimenu>.
</para></step>
When the user elects to make the
2009 May 06
0
problems in h323 channels
Hi, all!
when my h323 phone dial in Asterisk system, i can hear nothing. and
the following is the log slice i picked from /var/log/asterisk/full.
ps: i am using red hat AS5 kernel 2.6.18-53.el5,Asterisk-1.4.24.1,
pwlib_v1_11_0, openh323_v1_19_0_1.
Best
Regards!
81948 [May 6 10:07:34] VERBOSE[11579] logger.c: -- Remote UNIX connection
81949 [May 6 10:07:51] VERBOSE[29627] logger.c:
2005 Jul 03
0
H323 with GSM codec is not working
Hello,
I'm trying to use the GSM codec with Nufone H323 but it's not working.
Does somebody has some idea? Have I missed something?
Thanks!!
Celso Fassoni
Some additional info:
(I'm using CVS-HEAD - downloaded today)
monkey:~# cat /etc/asterisk/h323.conf
[general]
port = 1720
bindaddr = 192.168.0.100 ; this SHALL contain a single, valid
IP address for this machine
2007 Jan 26
1
Using Windows API functions in R
Somehow autofilter doesn't allow this message to be posted,
will try another time.
-----Original Message-----
From: Yuri Volchik <volchik2000 at list.ru>
To: r-devel at r-project.org
Date: Thu, 25 Jan 2007 22:27:13 +0000
Subject: Using Windows API functions in R
>
> Hi to all.
>
> In programming one application i have to "press" button to have
> application
2005 Jan 27
0
Problem with OpenPhone->Asterisk
Hello all,
I just installed Asterisk with H323 support (chan_h323 from Jeremy
McNamara). But experience problem while connecting OpenPhone to Asterisk
Here is h.323 trace:
5:37.444 H323 Listener:9c86de0 transports.cxx(1504) H323TCP
Started connection: host=10.120.160.15:3172, if=10.120.160.99:1720,
handle=27
5:37.444 H225 Answer:9cc1250 transports.cxx(564) H225
2007 Sep 02
4
IMAP: Disconnected: BUG: Unknown internal error (Dovecot 1.0.3)
Hi,
I am getting the following error in the server mail logfile:
> Sep 2 18:39:44 h648123 dovecot: IMAP(<account>)(<PID>): Disconnected: BUG: Unknown internal error
(mail_debug is on, but there is not really much context for this in
the log file, ie. no log events for several minutes, and then it
appears, all of a sudden).
On the client side, it looks like this (with some
2008 Aug 28
1
ADS Trouble authorizing users.
Hi all,
I've set up a CentOS machine with samba version 3.0.28-1.el5_2.1 to join a
Windows 2003 ADS. Everything seemed to go fine while joining the domain:
[root@mailserver ~]# net ads join -U administrator
administrator's password:
Using short domain name -- MYDOMAIN
Joined 'MAILSERVER' to realm 'MYDOMAIN.LOCAL'
The trouble I'm having is authorizing users.
When
2003 Sep 15
1
winbindd using FQDN domain name now?
As of RC3 and RC4, I've noticed that winbindd's wb_getpwuid function
is using the form <FQDN-domain><winbind-seperator><username>, and
before, it was simply <NetBIOS-domain><winbind-seperator><username>.
The net effect of what I'm seeing is that users which have a UNIX
account locally on the samba box and also a domain account are being