search for: scripsit

Good day, The use of "rounding" also doesn't make sense. If The number is halfway between two integers, it is rounded to the nearest even integer. > round(2.5) [1] 2 -------------------------------------- Dario Strbenac University of Sydney Camperdown NSW 2050 Australia

FWIW, I suspect this is related to the function R_unif_index that was introduced in src/main/RNG.c around revision 72356, or the way this function is used in do_sample in src/main/random.c. 20.9.18 08:19, Wolfgang Huber scripsit: > Besides wording of the documentation re truncating vs rounding, there is > something peculiar going on with the fractional part of n: > > > table(sample.int(2.5, 1e6, replace = TRUE)) > > ???? 1????? 2????? 3 > 399051 401035 199914 > > > table(sample.int(3...

...else value } > is(ma, "vector") [1] TRUE I got that in a fresh session of > sessionInfo() R Under development (unstable) (2017-04-18 r72542) Platform: x86_64-apple-darwin16.5.0 (64-bit) Running under: macOS Sierra 10.12.4 Best wishes Wolfgang 19.4.17 10:01, Hilmar Berger scripsit: > Hi, > > following up on my own question, I found smaller example that does not > require LIMMA: > > setClass("FOOCLASS", > representation("list") > ) > ma = new("FOOCLASS", list(M=matrix(rnorm(300), 30,10))) > >> ma * ma$...

..._US.UTF-8/UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] fortunes_1.5-4 loaded via a namespace (and not attached): [1] compiler_3.6.0 tools_3.6.0 20.9.18 03:00, Dario Strbenac scripsit: > Good day, > > The use of "rounding" also doesn't make sense. If The number is halfway between two integers, it is rounded to the nearest even integer. > >> round(2.5) > [1] 2 > > -------------------------------------- > Dario Strbenac > Universit...

...on bug, and hopefully not one that should trigger often in practice... and -- without any statistics about the consequences out in package space -- I do think we should fix this in code and let the documentation become "great again" ;-) Martin > 20.9.18 08:19, Wolfgang Huber scripsit: >> Besides wording of the documentation re truncating vs >> rounding, there is something peculiar going on with the >> fractional part of n: >> >> > table(sample.int(2.5, 1e6, replace = TRUE)) >> >> ???? 1????? 2????? 3 399...

Hey group, I have a problem of drawing dendrogram as the result of my program written in C. My algorithm is a approximation algorithm for single linkage method. AS a result I will get the following data: [Average distance] [cluster A] [cluster B] For example: 42.593141 1 26 42.593141 4 6 42.593141 123 124 42.593141 4 113 74.244206 1 123 74.244206 4 133 74.244206 1 36 So far I have used C to

Hi! using ppmtolss16 tool from syslinux-2.04 with an input .pnm file created with gimp 1.2.3, I bumbed into the following error: [root at azur syslinux-2.04]# ./ppmtolss16 < /home/sr/try.pnm > /tmp/t ./ppmtolss16: Input format error 1 [root at azur syslinux-2.04]# The problem is that gimp adds the comment # CREATOR: The GIMP's PNM Filter Version 1.0 at 2nd line. Suggested fix for

Hi all, I''m searching for a tutorial how to setup multiple network cards with xen network bridge setup in debian lenny. My problem is, bridges seams only to work if i put an ip adress in dom0 to them. Thanks, Alex _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

Hi the list, I define a method that want to change an object without assignation (foo(x) and not x<-foo(x)) using deparse and assign. But when the argument of the method does not match *exactly* with the definition of the generic function, assign does not work... Anything wrong? Christophe #------ Does not work ------#

Um texto embutido e sem conjunto de caracteres especificado associado... Nome: n?o dispon?vel Url: https://stat.ethz.ch/pipermail/r-help/attachments/20080208/bf7b4696/attachment.pl

...t; > I got that in a fresh session of >> >> sessionInfo() > > R Under development (unstable) (2017-04-18 r72542) > Platform: x86_64-apple-darwin16.5.0 (64-bit) > Running under: macOS Sierra 10.12.4 > > Best wishes > Wolfgang > > 19.4.17 10:01, Hilmar Berger scripsit: >> >> Hi, >> >> following up on my own question, I found smaller example that does not >> require LIMMA: >> >> setClass("FOOCLASS", >> representation("list") >> ) >> ma = new("FOOCLASS", list(M=matri...

Hi, I''ve been posting this question to lots of lists and not getting good answers. I have a Ubuntu Hardy laptop. With a ssh connection to a RHEL5 xen dom0. Running cobbler/koan on the dom0 Koan --virt --nogfx ... starts a new domU on the xen box and starts up the RHEL5 installer the installer attempts to configure its network interface using DHCP and gets stuck If this was an install

My server and client are running Ubuntu Lucid, libvirt-bin 0.7.5-5ubuntu27, qemu-kvm-0.12.3+noroms-0ubuntu9 and I'm using virt-viewer-0.0.3-6ubuntu7.xul19 or virt-manager-0.8.2-2ubuntu8 to connect. I configured SASL2 to use GSSAPI for libvirt following the instructions in the libvirt docs, created a keytab with libvirt/my.fully.qualified.domain at MY-REALM.COM (has a dash fwiw) and pointed

hi, I have to configure Xen server and DomU''s which should be able to talk to different vlans - depending on services put on DomU''s. I would like to enslave 2 NICs via bond interface. Both NICs are on trunk ports which are configured in the same way, the same native vlan. I don''t know, if I have to add vlans tagging to eth* interfaces then enslave tagged eth*

Hi, this is a problem that occurs in the presence of two libraries (limma, xlsx) and leads to a crash of R. The problematic code is the wrong application of sweep or the product ("*") function on an LIMMA MAList object. To my knowledge, limma does not define a "*" method for MAList objects. If only LIMMA is loaded but not package xlsx, the code does not crash but rather

Just reporting some iperf results. In each case, Dom0 is iperf server, DomU is iperf client: (1) Dom0: Intel Core2 3.16 GHz, CentOS 5.2, xen 3.0.3. DomU: Windows XP SP3, GPLPV 0.9.12-pre13, file based. Iperf: 1.17 Gbits/sec (2) Dom0: Intel Core2 2.33 GHz, CentOS 5.2, xen 3.0.3. DomU: Windows XP SP3, GPLPV 0.9.12-pre13, file based. Iperf: 725 Mbits/sec (3) Dom0: Intel Core2 2.33 GHz,

Hi - Is there someone around who successfully got cLVM on Debian/Lenny working? I was wondering if I was the only one facing problems with... Thanks in anticipation, -- Olivier Le Cam Département des Technologies de l''Information et de la Communication CRDP de l''académie de Versailles _______________________________________________ Xen-users mailing list

...e hierarchical clustering result To: noorpiilur <noorpiilur at yahoo.com> Cc: r-help at r-project.org Message-ID: <47B020DC.1020202 at ebi.ac.uk> Content-Type: text/plain; charset=ISO-8859-1 Hi Risto, You could try example("dendrogram") best wishes Wolfgang noorpiilur scripsit: > Hey group, > > I have a problem of drawing dendrogram as the result of my program > written in C. My algorithm is a approximation algorithm for single > linkage method. AS a result I will get the following data: > > [Average distance] [cluster A] [cluster B] > > For...