Displaying 20 results from an estimated 69 matches for "atcs".
Did you mean:
acts
2010 Jul 28
0
Call for Demos and Exhibition: The 7th International Conference on Autonomic and Trusted Computing (ATC 2010)
The 7th International Conference on Autonomic and Trusted Computing (ATC
2010)
Call for Demos and Exhibition
Highlight: ATC demos will be published on IEEE CS proceedings (indexed
by EI)!
The ATC 2010 demo/exhibition program provides researchers and engineers
with opportunities to show their cutting-edge work presented in an
interactive fashion. The live
2010 Jul 28
0
Call for Demos and Exhibition: The 7th International Conference on Autonomic and Trusted Computing (ATC 2010)
The 7th International Conference on Autonomic and Trusted Computing (ATC
2010)
Call for Demos and Exhibition
Highlight: ATC demos will be published on IEEE CS proceedings (indexed
by EI)!
The ATC 2010 demo/exhibition program provides researchers and engineers
with opportunities to show their cutting-edge work presented in an
interactive fashion. The live
2010 Jun 25
1
Call for Demos and Exhibition: The 7th International Conference on Autonomic and Trusted Computing (ATC 2010)
Call for Demos and Exhibition
The 7th International Conference on Autonomic and Trusted Computing (ATC
2010)
Xi'an China, October 26-29, 2010
http://www.nwpu.edu.cn/atc2010/
The ATC 2010 demo/exhibition program provides researchers and engineers
with opportunities to show their cutting-edge work presented in an
interactive fashion. The live demonstrations and exhibitions may include
2010 Jun 25
1
Call for Demos and Exhibition: The 7th International Conference on Autonomic and Trusted Computing (ATC 2010)
Call for Demos and Exhibition
The 7th International Conference on Autonomic and Trusted Computing (ATC
2010)
Xi'an China, October 26-29, 2010
http://www.nwpu.edu.cn/atc2010/
The ATC 2010 demo/exhibition program provides researchers and engineers
with opportunities to show their cutting-edge work presented in an
interactive fashion. The live demonstrations and exhibitions may include
2011 Dec 27
9
Unable to register the DLL/OCX
I am new to Wine and anything like it. I want to run the application "ATCS Monitor". When I installed ATCS Monitor I received an error message:
C:\windows\system32\wshom.ocx
Unable to register the DLL/OCX: RegSvr32 failed with exit code 0x1
-From Terminal-
err:typelib:sltg_get_typelib_ref Unable to find reference
err:module:import_dll Library ScrRun.dll (which...
2008 Jan 23
1
OCFS2 DLM problems
Hello everyone, once again.
We are running into a problem, which has shown now 2 times, possible 3
(once the systems looked different.)
The environment is 6 HP DL360/380 g5 servers with eth0 being the public
interface, eth1 and bond0 (eth2 and eth3) used for clusterware and bond0
also used for OCFS2. The bond0 interface is in active/passive mode.
There are no network errors counters showing and
2007 Mar 06
6
Desynchronize clock
I don''t want my dom0 to update the clock in my HVM domU. I''ve already
disabled network-based time synchronization inside the HVM. I''ve tried
setting /proc/sys/xen/independent_wallclock=1 and then restarting xend, but
the guest still gets the correct time.
Any ideas on how to accomplish this?
Steve Brueckner, ATC-NY
_______________________________________________
2006 Oct 10
3
Can't map ntgroup to unix group
1. Here's my case:
[root@dsat ~]# net groupmap list
[root@dsat ~]# net groupmap add rid=512 ntgroup="Domain Admins"
unixgroup=domainadmins
adding entry for group Domain Admins failed!
2. Here's samba log:
[root@dsat ~]# tail /var/log/smbd.log
[2006/10/10 08:51:23, 0] lib/smbldap.c:smbldap_connect_system(851)
ldap_connect_system: Failed to retrieve password from secrets.tdb
2007 Jul 07
2
Adding new nodes to OCFS2?
I looked around, found older post which seems not applicable anymore. I
have a cluster of 2 nodes right now, which has 3 OCFS2 file systems. All
the file systems were formatted with 4 node slots. I added the two news
nodes (by hand, by ocfs2console and o2cb_ctl), so my
/etc/ofcfs/cluster.conf looks right:
node:
ip_port = 7777
ip_address = 192.168.201.1
number = 0
2005 Dec 15
1
RE: ssh in rc.local stalls xenU [SOLVED]
Karsten M. Self wrote:
> on Thu, Dec 15, 2005 at 01:38:29PM -0500, Steve Brueckner
> (steve@atc-nycorp.com) wrote:
>> I''m using Fedora Core 4. I need to create an ssh port forwarding
>> tunnel to my xen0 domain when my xenU domain starts up, so I added
>> this to the xenU''s /etc/rc.d/rc.local:
>>
>> ssh -v -f -L 5500:localhost:5501 xen0_ip
2008 Feb 25
2
OCFS2 and Cloning
I am working currently on cloning on a regular basis our production
OCFS2 volumes to our test environment. For the database (Oracle 10G R2
RAC) we put it into backup mode, then execute a Snapclone on our 3Par
SAN. Then we use RemoteCopy and SnapClone to our development 3Par SAN.
To recover the OCFS2 volume I got through the following steps:
Stop database
umount /export/<volume name>
Log
2008 Oct 27
0
New Xen.org Project: Xen Introspection Project
Xen Community:
I have been asked by Steve Brueckner of ATC-NY and some of his
colleagues to create a new Xen.org project - Xen Introspection Project:
to design an API for performing VM introspection and implementing the
necessary functionality into Xen. If you are interested, please email me
back and I will add you to the project member list. I will be sending
out an email later this week to
2008 Oct 27
0
New Xen.org Project: Xen Introspection Project
Xen Community:
I have been asked by Steve Brueckner of ATC-NY and some of his
colleagues to create a new Xen.org project - Xen Introspection Project:
to design an API for performing VM introspection and implementing the
necessary functionality into Xen. If you are interested, please email me
back and I will add you to the project member list. I will be sending
out an email later this week to
2008 Oct 27
0
New Xen.org Project: Xen Introspection Project
Xen Community:
I have been asked by Steve Brueckner of ATC-NY and some of his
colleagues to create a new Xen.org project - Xen Introspection Project:
to design an API for performing VM introspection and implementing the
necessary functionality into Xen. If you are interested, please email me
back and I will add you to the project member list. I will be sending
out an email later this week to
2001 Mar 12
2
How to debug/fix "err:win32:fixup_imports"
I ran into the following error message :
---snipp---
Call kernel32.495: LoadLibraryA(102951c8 "ctmp3Lib.dll") ret=1025f5ad fs=008f
Call kernel32.922: __wine_register_dll_16(418ff5ac) ret=418bd4f0 fs=008f
Ret kernel32.922: __wine_register_dll_16() retval=418ff5ac ret=418bd4f0 fs=008f
err:win32:fixup_imports No implementation for
NTDLL.dll.3(IoUnregisterDeviceInterface), setting to
2009 Jun 25
2
ConVirt 1.1 is released.
Hi
We are extremely happy to announce ConVirt 1.1 release.
For details please visit :
http://www.convirture.com/blog/2009/announcements/convirt-11-is-now-available/
ConVirt Team.
_______________________________________________
Xen-users mailing list
Xen-users@lists.xensource.com
http://lists.xensource.com/xen-users
2007 Mar 11
1
samba+Ldap+smbldap-tools
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1
hi,
I have aproblem with the smbldap-tools...when I try to change the
passwd fron a user in win...I get the error "....", and I know that the
script of smbldap-tools fails when try to execute the next line:
# non-root user
if (!defined($oldpass)) {
# prompt for current password
system "stty -echo";
print "(current)
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2006 May 18
4
Fail to create hvm domain
I''m using FC5 with its Xen 3.0.2-2 package and 2.6.16-1.2118_FC5xen0 kernel.
I''ve got a Pentium 9xx chip with virtualization enabled in the BIOS; it
appears to be VT-enabled, since xm dmesg includes "(XEN) VMXON is done". I
base my config file on example.hvm and on previous emails to this list.
Unfortunately, I don''t get very far.
xm create winxp.conf
2008 May 21
7
Debugging the hypervisor
I am trying to debug the Xen hypervisor from a second computer over the
serial port, but nothing seems to work. Using mercurial, I got
xen-3.2-testing.hg. I followed the steps in crashdb.txt in the docs/misc/
folder:
set debug=y in Config.mk, crash_debug=y in xen/Rules.mk
I also added -fno-omit-frame-pointer to these file as well.
I compiled with no errors and booted with minicom connected to